03-12-2021
Mathematics

contestada

Factor the following Trinomial:
x^2-3x+1

Respuesta :

jakelouise1006 jakelouise1006

03-12-2021

Answer:

The factors are (x-4) and (x+1)

(x-4)(x+1) = x²+x-4x-4 = x²-3x-4

Step-by-step explanation:

(x-4)(x+1) = x²+x-4x-4 = x²-3x-4

Answer Link

Otras preguntas

PLEASE HELP ME ASAP Identify the area of the polygon with vertices P (1, 2), Q (1, 4), R (−1, 6), and S (−3, 2).

Identify the vertical asymptote(s) of each function. Check all of the boxes that apply. f(x)=3x/x^2-16 Answers: x = -16 x = -4 x = 0 x = 4 x = 16

Observing people and asking them questions are the two principal ways to obtain

A train leaves new york at 4:00 pm. a second train leaves the same city in the same direction at 6:00 pm. the second train travels 60mph faster than the first.

the push or pull that exists between interacting objects is

Which ordered pair is a solution to the system of equations? {2x−y=−1 {2x−4y=8 A-(−2, −3) B-(8, 2) C-(1, 3) D-(7, −5)

235u92 and 238u92 are examples of _____. select one: a. particles of radiation b. allotropes c. tracers d. isotopes

A circular swimming pool has a diameter of 12 feet. What is the circumference the pool? Use 3.14 to approximate for π . Enter your answer, as a decimal rou

which goal stated in the preamble to the u.s. constitution requires a strong army

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat