Tokyo34890 Tokyo34890

01-11-2021
Mathematics

contestada

Please help i give brainliest

Please help i give brainliest class=

Respuesta :

softmocha14 softmocha14

01-11-2021

I think it is B or A, but manly A

Answer Link

001397828 001397828

01-11-2021

Answer: A

Step-by-step explanation:

Answer Link

Otras preguntas

When did Christianity become the official religion for the Roman Empire

4/y+2 - 9/y-2 = 9/y^2-4

help asap homework due soon 20 pts Read each verbal expression Then assign a variable and distribute

Find the least common multiple of the pair of polynomials. 2y^2-32 and y+4

You have four coins 1 ¢ 5 ¢ 10 ¢ 25 ¢ How many different sums of money can you select? Use set notation to list all the options you have. How many options wi

What did lamarck contribute to the theory of evolution? 101. explain the information that influenced darwin's view of natural selection/ evolution. 102. define

What is the difference between a settler an an explorer social studies?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

what is r in this equation? πr^2=42π

Completa la frase con el mandato correcto. (Complete the sentence with the correct command.) Acabo de limpiar la cocina. Elena, __________ a la tienda para comp