hernameishere22 hernameishere22
  • 02-06-2021
  • Social Studies
contestada

Some of the fiercest fighting on day two at the Battle of Gettysburg
happened at places called Devils Den, the Peach Orchard, and Little Round Top.
True or False

Respuesta :

jazzytaz27
jazzytaz27 jazzytaz27
  • 02-06-2021

Answer:

True

Explanation:

Important Events:

Little Round Top

Devil’s Den

Battle of the Wheatfield

Battle of the Peach Orchard

Battle of Cemetery Hill

Answer Link
aniyah12259 aniyah12259
  • 02-06-2021
the answer to your question is true
Answer Link

Otras preguntas

I solved some of it but now I don't know if you continue it correctly ... To be performed: (lesson: Raducali of order "n")​
Please help. Thanks <3
Please please please help me asap!
Is Gawain justified in his actions of breaking one rule to avoid breaking another
What organelles act as the boss inside of a cell
The Westland Lysander was an aircraft used by the Royal Air Force in the 1930s. Here are some scale drawings that show the top, side, and front views of the Lys
Find the percent change from 72 to 90.Is it decrease or an increase
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Solve: (2x + 3)/(x - 3) = 3/5 find the value of x and verify that LHS = RHS ?​
135 item was marked down by 30%