kemyiabaker77 kemyiabaker77

03-05-2021
Chemistry

contestada

What type of observation can be stated with just numbers?
A. Qualitative
B. Sensory
C. Behavioral
D. Quantitative

Respuesta :

DrippQueenMo DrippQueenMo

03-05-2021

Answer:

D. Quantitative

Explanation:

Quantitative observation deals with numbers, or amounts.

Qualitative observation deals with de- scriptions that cannot be expressed in numbers.

Answer Link

Otras preguntas

A drug company is testing the effectiveness of a new blood pressure medicine using rats as test subjects what are some possible factors that must remain constan

A wall that is 10 feet high and 20 feet long contains one ton of bricks. How many tons should be purchased to brick a wall that measures 1,800 square feet?

The Fifteenth Amendment was ratified in order to — *

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

1. $7,000 of merchandise inventory was ordered on September 2, 2009 2. $3,000 of this merchandise was received on September 5, 2009 3. On September 6, 2009, an

is it right for us to use the phrase ‘Spirit of the Blitz’? please a P.E.E paragraph

The guys ( jurors ) didn’t buy into science fiction

any even number greater than 2 can make a sum of 2 prime numbers

Tony ran 4.8 miles. james ran 2.75 miles . How much farther did tony run

Commercial sports are most likely to grow and prosper in societies with