taylorcecileee taylorcecileee
  • 01-10-2020
  • Mathematics
contestada

While working at the drugstore, Sam earns $9 per hour. How many hours will it take Sam to earn $45? Choose
the correct answer from the following options.

Respuesta :

ninjathan300
ninjathan300 ninjathan300
  • 01-10-2020

Answer:

The answer is 5 hours

Step-by-step explanation:

The answer is 5 Hours because 45 divided by 9 equals 5

Answer Link

Otras preguntas

Cuanto es (2x+2y=20) (-2x-6y=-52) con método de igualación y método de suma y resta
World war 2 officially began with hostilities between what two nations A. Japan and the United States B. Germany and Poland C. Japan and China D. Germany an
what is the answer to #16???? Helpppppp
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Differences between body composition- risk for heart disease or chronic disease.
Arrange the complex numbers in order according to the quadrant in which they appear, starting with the first quadrant. Tiles: 3 − 4i -1 − 3i 4 + i -2 + 2i
Which is a function of the placenta? it helps keep the embryo's temperature constant. it cushions the embryo from shock. it protects the embryo it nourishes the
Help! Exponential Equation WITHOUT CALCULATOR
In the reversible reaction shown below, r moles of a react with s moles of b to produce t moles of c. which equation can be used to represent the equilibrium co
what are good websites to study for biology?