danibob0962 danibob0962

02-04-2020
Mathematics

contestada

Jack is paid biweekly. His annual salary is $48,200. What is his biweekly salary, rounded to
the nearest cent?

Respuesta :

fussellk fussellk

02-04-2020

Answer:

1853.85

Step-by-step explanation:

52 weeks in a year but he gets paid every two week....

52/2 = 26

48200/26 =1853.85

Answer Link

Otras preguntas

great Britain is an example of a core nation True or False

Find the missing length indicated

In judith ortiz cofer's "gravity," what is elenita's main internal conflict? a.she wants an independent identity, and yet still feels a connection to others. b.

a club has 5 members. from these members, the positions of president and vice-president have to be filled. how many different ways can these 2 positions be fill

Which american colony was established in the 1660s as a haven for quakers?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

15 points to whoever can answer this question!!!! Five countries are competing in the high jump at the Olympics. Each country reached a certain height ( meter

An account earns simple interest. Find the annual interest rate, I= $60 P= $500 t= 2 years

What is the First Language On world?

2. For centuries, Africans enslaved other Africans. Name the two later slave trades that transported millions of Africans to distant lands to work.